Dinuclear polypyridyl ruthenium(II) complexes as stereoselective probes of nucleic acid secondary structures
Smith, Jayden A. (2008) Dinuclear polypyridyl ruthenium(II) complexes as stereoselective probes of nucleic acid secondary structures. PhD thesis, James Cook University.
| PDF (Thesis front) - Requires a PDF viewer such as GSview, Xpdf or Adobe Acrobat Reader 440Kb | |
| PDF (Chapters 1-3) - Requires a PDF viewer such as GSview, Xpdf or Adobe Acrobat Reader 4075Kb | |
| PDF (Chapters 4-6) - Requires a PDF viewer such as GSview, Xpdf or Adobe Acrobat Reader 1809Kb | |
| PDF (Appendices) - Requires a PDF viewer such as GSview, Xpdf or Adobe Acrobat Reader 4Mb |
Abstract
This thesis reports on the nucleic acid-binding properties of a series of dinuclear polypyridylruthenium(II) complexes of the general form [{Ru(pp)2}2(μ-BL)]4+ {where pp = 2,2′-bipyridine (bpy), 4,4′-dimethyl-2,2′-bipyridine (Me2bpy), 5,5′-dimethyl-2,2′-bipyridine (5,5′-Me2bpy), 1,10-phenanthroline (phen), and 4,7-dimethyl-1,10-phenanthroline (Me2phen); BL = 2,2′-bipyrimidine (bpm), 1,4,5,8,9,12-hexaazatriphenylene (HAT), 1,4,5,12- tetraazatriphenylene (4,7-phenanthrolino-5,6:5′,6′-pyrazine; ppz), 2,3-bis(2-pyridyl)pyrazine (2,3-dpp), and 2,5-bis(2-pyridyl)pyrazine (2,5-dpp)}. These complexes encompass three general geometries as governed by their bridging ligands – “linear” (bpm), “angular” (HAT, ppz, 2,3-dpp) and “stepped-parallel” (2,5-dpp) – and incorporate a systematic variation of terminal ligand hydrophobicity and bulk. The stereoisomers of each complex were isolated by means of cation-exchange chromatography and characterisation was achieved using 1H NMR and CD spectroscopy.
Fluorescent Intercalator Displacement (FID) assays were used to survey to relative binding affinities of this array of complexes to a library of oligonucleotides incorporating a variety of different duplex, bulge, hairpin loop and quadruplex-forming sequences. Notable trends were observed with respect to terminal ligand identity (increased hydrophobicity typically correlated to stronger binding), bridging ligand identity (the “angular” class of complex was usually the strongest binding), and stereochemistry (the meso diastereoisomer of a given complex typically demonstrated the greatest affinity). Additionally, the metal complexes generally demonstrated a heightened affinity for more open oligonucleotide structures such as bulges and loops, as well as AT-rich duplex sequences.
A small number of discrepancies were noted in the results of the FID assays wherein the relative order of binding affinity implied by the FID assay contradicted that suggested by other experiments (NMR, equilibrium dialysis, affinity chromatography). These discrepancies were rectified by replacing the intercalating dye used in the assay (ethidium bromide) with the minor groove-binder DAPI (4′,6-diamidino-2-phenylindole), the binding mode of which more closely resembles that of the metal complexes being investigated.
Electronic absorption titration experiments conducted with several of the complexes and calf thymus DNA confirmed the correlations between ligand identity and stereochemistry seen in the FID (and modified DAPI-displacement) assays. Intrinsic binding constants obtained from these titrations were within the range of mid-104 to low-105 M-1, consistent with previously published values for dinuclear complex-calf thymus DNA interactions. Analogous titrations using yeast tRNA yielded binding constants of a similar magnitude, but in these experiments no clear relationship was evident between the nature of a given complex and its binding affinity. One- and two-dimensional NMR experiments were used to probe in greater detail several of the more notable metal complex-oligonucleotide interactions (as implied by the results of the FID assays). These experiments confirmed the minor groove-binding nature of this genre of metal complex and reaffirmed the oligonucleotide selectivities implied by the FID assays. [{Ru(bpy)2}2(μ-bpm)]4+ and [{Ru(Me2bpy)2}2(μ-bpm)]4+ were found to bind poorly to a duplex control sequence {d(CCGGAATTCCGG)2} and relatively weakly to the analogous sequence possessing a single-base bulge {d(CCGAGAATTCCGG)2} and an octadecanucleotide containing a four-base hairpin loop {d(CACTGGTCTCTACCAGTG)}, all consistent with the affinities demonstrated by these particular complexes in the FID experiments. Conversely, the meso diastereoisomers of [{Ru(phen)2}2(μ-HAT)]4+ and [{Ru(Me2phen)2}2(μ-HAT)]4+ confirmed their strong affinities to a six-base hairpin loop sequence {d(CACTGGTCTCTCTACCAGTG)}. Each complex bound strongly to the stem-loop interface of the icosanucleotide as evidenced by selective broadening of T-methyl and aromatic resonances corresponding to protons within the loop/stem-loop interface. The extent of broadening observed in these NMR experiments, coupled with the performance of each complex in the FID assays, suggests a stronger yet less selective interaction by the Me2phenversion of the complex. This significant broadening of both the icosanucleotide and metal complex spectra prohibited a thorough NOESY characterisation of the binding, but the few NOE signals that were obtained confirmed binding of the complexes at the stem-loop interface and facilitated the construction of molecular models of each interaction.
NMR experiments were also used to investigate the unexpectedly-favourable association meso-[{Ru(phen)2}2(μ-ppz)]4+ and the duplex oligonucleotide sequence d(ATATATATATAT)2. Again, both the metal complex and oligonucleotide spectra exhibited significant broadening upon interaction, suggesting moderate-to-strong binding. Furthermore, several resonances corresponding to terminal phenanthroline ligand protons underwent large upfield shifts. NOESY spectra revealed many strong NOE interactions between the terminal ligands of the complex and minor groove sugar resonances, assisting the development of a binding model. The high selectivity of meso-[{Ru(phen)2}2(μ-ppz)]4+ for AT-rich regions of duplex DNA was confirmed using a restriction enzyme inhibition assay wherein the metal complex was found to interfere with the action of a restriction endonuclease that cuts doublestranded DNA at the center of a TATA sequence.
The impressive selectivity inherent in many of these oligonucleotide-metal complex interactions has been exploited in the development of a DNA-based affinity chromatography technique for the highly efficient separation of different polypyridylruthenium(II) complexes, as well as the stereoisomers of individual complexes. Separations requiring effective column lengths in excess of 30 m on a cation-exchange column have been replicated using a column length of less than 5 cm. This technique has proven useful in qualitatively establishing relative binding affinities between complexes and a variety of oligonucleotides (duplex and nonduplex), and was one of the tools used to confirm the validity of the DAPI-modified fluorescent dye-displacement assay.
These studies demonstrate the utility of this genre of rigid dinuclear metal complexes as sequence- and structure-selective probes of nucleic acids. Honing and targeting this selectivity to specific biologically-relevant targets through a rational choice of ligands, functionality and stereochemistry may potentially yield a new generation of more efficacious diagnostic and therapeutic agents.
| ID Code: | 2082 |
|---|---|
| Item Type: | Thesis (PhD) |
| Keywords: | fluorescent assay, FID assay, dinuclear polypyridyl ruthenium (II) complexes, dinuclear ruthenium, nucleic acids, chromatography, stereochemistry, DNA, binding properties, electronic absorption spectroscopy, NMR spectroscopy, DNA –affinity chromatography, Nuclear Overhauser Effect Spectroscopy, NOESY, ligands, binding selectivity, 4,6-Diamidino-2-phenylindole, DAPI |
| FoR Codes: | 03 CHEMICAL SCIENCES > 0302 Inorganic Chemistry > 030201 Bioinorganic Chemistry @ 0% |
| SEO Codes: | UNSPECIFIED |
| Deposited On: | 26 Feb 2009 11:49 |
| Last Modified: | 13 Feb 2011 20:27 |
| Downloads: | Total: 865 Last 12 Months: 173 |
| Statistics: | More Statistics |
Repository Staff Only: item control page